Rabbit hemorrhagic disease virus (RHDV) is a lagovirus from the Caliciviridae family that affects the European rabbit (Oryctolagus cuniculus), causing the rabbit hemorrhagic disease (RHD), a highly contagious, acute and fulminating disease. The virus is classified into four genotypes: GI.1 and GI.2 are pathogenic forms and GI.3 and GI.4 are non-pathogenic forms.
Since RHDV is a lethal virus responsible for industrial losses and ecological disturbances, a correct identification and characterization of the different strains is crucial to implement adequate control measures.
RHDV Database is a freely accessible database that sorts the oligonucleotides (primers) used in the reverse transcription (RT)-PCR for the detection and identification of RHDV. This database intends to sort automatically retrieved RHDV oligonucleotides from the literature (AROLit DB) and in-silico oligonucleotides generated in python (iSOP) by their conservation scores, thereby contributing to increased efficiency in the identification and characterization of RHDV strains.
RHDV Database (AROLit DB and iSOP DB) follows the FAIR principles: Findability, Accessibility, Interoperability, and Reuse of digital assets.
The top primer combinations according to their conservation scores and genome region:
AROLit DB TOP 5
ID Forward | Sequence Forward | ID Reverse | Sequence Reverse | %GC F | %GC R | Tm F (ºC) | Tm R (ºC) | %No-fold | Region | Amplicon (bp) | Final Conservation Score |
---|---|---|---|---|---|---|---|---|---|---|---|
513 | ATGGCTTTTCTTATGTCTG | 271 | CTACACTAGCATCATTATGCAT | 36,84 | 36,36 | 44,62 | 49,25 | 29,92 | VP60 - VP10 | 225 | 97,88 |
515 | AGAACACACCCATCATGTTCGC | 271 | CTACACTAGCATCATTATGCAT | 50,00 | 36,36 | 54,84 | 49,25 | 31,51 | VP60 - VP10 | 576 | 97,54 |
778 | GTGAATGTTATGGAGGGCAAAGCCCG | 160 | CTTGTTGGTCCACCTGTTG | 53,85 | 52,63 | 61,12 | 51,09 | 16,7 | RdRp - VP60 | 179 | 97,43 |
106 | TCCTGGACCTCAGGGACAAGA | 273 | CAACGTCAACAAACTTGTCC | 57,14 | 45,00 | 56,31 | 49,13 | 33,46 | p16 - p23-p26 | 450 | 92,18 |
493 | GACTACTCAAAGTGGGACTCC | 62 | CGGGCTTTGCCCTCCATAACATTC | 52,38 | 54,17 | 54,36 | 59,09 | 20,22 | RdRp | 791 | 93,18 |
iSOP DB TOP 6
ID Forward | Sequence Forward | ID Reverse | Sequence Reverse | %GC F | %GC R | Tm F (ºC) | Tm R (ºC) | %No-fold | Region | Amplicon (bp) | Final Conservation Score |
---|---|---|---|---|---|---|---|---|---|---|---|
10583 | ATTTGTGAATGTTATGGA | 3586 | GCCCAGCCAGCGTACATC | 27,78 | 66,67 | 38,93 | 54,88 | 79,89 | RdRp - VP60 | 336 | 98,55 |
191 | CAAGACCCCTCCCTGTTG | 14212 | CCGCAGTCGTGTATGTAG | 61,11 | 55,56 | 52,60 | 50,32 | 82,71 | p16 | 219 | 98,44 |
10583 | ATTTGTGAATGTTATGGA | 3070 | TTGATAAGGTTGTTGTAA | 27,78 | 27,78 | 38,93 | 38,93 | 100,00 | RdRp - VP60 | 594 | 98,22 |
14109 | TTGGGACTTGCAGGTGCC | 344 | ACACTAGCATCATTATGC | 61,11 | 38,89 | 52,60 | 43,49 | 69,72 | VP10 | 194 | 96,92 |
47183 | TATGACAGTTGTGAAAATGGC | 10402 | AAGTACTGTTTCCACATG | 38,10 | 38,89 | 48,50 | 43,49 | 90,94 | 2C - p29 | 882 | 96,56 |
4799 | GGGGTGTGTGAATATGAC | 8206 | CCCTCATAGTCATTGTCA | 50,00 | 44,44 | 48,04 | 45,77 | 54,70 | p29 - VPg | 918 | 96,30 |