RHDV Database

Rabbit hemorrhagic disease virus (RHDV) is a lagovirus from the Caliciviridae family that affects the European rabbit (Oryctolagus cuniculus), causing the rabbit hemorrhagic disease (RHD), a highly contagious, acute and fulminating disease. The virus is classified into four genotypes: GI.1 and GI.2 are pathogenic forms and GI.3 and GI.4 are non-pathogenic forms.

Since RHDV is a lethal virus responsible for industrial losses and ecological disturbances, a correct identification and characterization of the different strains is crucial to implement adequate control measures.

RHDV Database is a freely accessible database that sorts the oligonucleotides (primers) used in the reverse transcription (RT)-PCR for the detection and identification of RHDV. This database intends to sort automatically retrieved RHDV oligonucleotides from the literature (AROLit DB) and in-silico oligonucleotides generated in python  (iSOP) by their conservation scores, thereby contributing to increased efficiency in the identification and characterization of RHDV strains.

RHDV Database (AROLit DB and iSOP DB) follows the FAIR principles: Findability, Accessibility, Interoperability, and Reuse of digital assets.

The top primer combinations according to their conservation scores and genome region:

AROLit DB TOP 5

ID Forward Sequence Forward ID Reverse Sequence Reverse %GC F %GC R Tm F (ºC) Tm R (ºC) %No-fold Region Amplicon (bp) Final Conservation Score
513 ATGGCTTTTCTTATGTCTG 271 CTACACTAGCATCATTATGCAT 36,84 36,36 44,62 49,25 29,92 VP60 - VP10 225 97,88
515 AGAACACACCCATCATGTTCGC 271 CTACACTAGCATCATTATGCAT 50,00 36,36 54,84 49,25 31,51 VP60 - VP10 576 97,54
778 GTGAATGTTATGGAGGGCAAAGCCCG 160 CTTGTTGGTCCACCTGTTG 53,85 52,63 61,12 51,09 16,7 RdRp - VP60 179 97,43
106 TCCTGGACCTCAGGGACAAGA 273 CAACGTCAACAAACTTGTCC 57,14 45,00 56,31 49,13 33,46 p16 - p23-p26 450 92,18
493 GACTACTCAAAGTGGGACTCC 62 CGGGCTTTGCCCTCCATAACATTC 52,38 54,17 54,36 59,09 20,22 RdRp 791 93,18

iSOP DB TOP 6

ID Forward Sequence Forward ID Reverse Sequence Reverse %GC F %GC R Tm F (ºC) Tm R (ºC) %No-fold Region Amplicon (bp) Final Conservation Score
10583 ATTTGTGAATGTTATGGA 3586 GCCCAGCCAGCGTACATC 27,78 66,67 38,93 54,88 79,89 RdRp - VP60 336  98,55
191 CAAGACCCCTCCCTGTTG 14212 CCGCAGTCGTGTATGTAG 61,11 55,56 52,60 50,32 82,71 p16 219  98,44
10583 ATTTGTGAATGTTATGGA 3070 TTGATAAGGTTGTTGTAA 27,78 27,78 38,93 38,93 100,00 RdRp - VP60 594  98,22
14109 TTGGGACTTGCAGGTGCC 344 ACACTAGCATCATTATGC 61,11 38,89 52,60 43,49 69,72 VP10 194  96,92
47183 TATGACAGTTGTGAAAATGGC 10402 AAGTACTGTTTCCACATG 38,10 38,89 48,50 43,49 90,94 2C - p29 882  96,56
4799 GGGGTGTGTGAATATGAC 8206 CCCTCATAGTCATTGTCA 50,00 44,44 48,04 45,77 54,70 p29 - VPg 918  96,30